Product Details

SNP ID: rs148681136
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35668621 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGTAGCCAGTTTTGGTGTGGGTGC[C/T]GCACTCTGCCGCCGCCGGTCCATGG
Phenotype: MIM: 124089 MIM: 611557
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COX6B1 PubMed Links

Gene Details

Gene: COX6B1
Gene Name: cytochrome c oxidase subunit 6B1

There are no transcripts associated with this gene.

Gene: UPK1A
Gene Name: uroplakin 1A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281443.1	279	Silent Mutation	GCC,GCT	A84A	NP_001268372.1
NM_007000.3	279	Silent Mutation	GCC,GCT	A84A	NP_008931.1
XM_017026225.1	279	Silent Mutation	GCC,GCT	A85A	XP_016881714.1

Gene: UPK1A-AS1
Gene Name: UPK1A antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details