Product Details

SNP ID: rs149506955
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1031111 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACCCCCAGAAGGAGGCAGAGCTCC[A/G]CACCTGGATCGAGGGACTCACCGGC
Phenotype: MIM: 605414 MIM: 602373 MIM: 611011
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ABCA7 PubMed Links

Gene Details

Gene: ABCA7
Gene Name: ATP binding cassette subfamily A member 7

There are no transcripts associated with this gene.

Gene: CNN2
Gene Name: calponin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303499.1	491	Missense Mutation	CAC,CGC	H35R	NP_001290428.1
NM_001303501.1	491	Missense Mutation	CAC,CGC	H35R	NP_001290430.1
NM_004368.3	491	Missense Mutation	CAC,CGC	H35R	NP_004359.1
NM_201277.2	491	Missense Mutation	CAC,CGC	H35R	NP_958434.1

Gene: RNU6-2
Gene Name: RNA, U6 small nuclear 2

There are no transcripts associated with this gene.

Gene: TMEM259
Gene Name: transmembrane protein 259

There are no transcripts associated with this gene.

View Full Product Details