Product Details
- SNP ID
-
rs149730386
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:8843123 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCAGCTCCTCTGCAAACAATTTCTG[A/G]TTACTGAGGAAGATATCAGGAAACA
- Phenotype
-
MIM: 607963
MIM: 606154
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MBD3L1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2969292] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MBD3L1
- Gene Name
- methyl-CpG binding domain protein 3 like 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_145208.2 |
531 |
Missense Mutation |
ATT,GTT |
I149V |
NP_660209.2 |
- Gene
- MUC16
- Gene Name
- mucin 16, cell surface associated
There are no transcripts associated with this gene.
View Full Product Details