Product Details

SNP ID
rs115932362
Assay Type
Functionally Tested
NCBI dbSNP Submissions
9
Location
Chr.1:175946580 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TAGAAAGTTCACTGCTTATCTCAGG[A/G]TTTATTTATCCAATGTATCATGTAC
Phenotype
MIM: 608067
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
RFWD2 PubMed Links
Additional Information
For this assay, SNP(s) [rs561621125] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
RFWD2
Gene Name
ring finger and WD repeat domain 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001001740.3 Intron NP_001001740.1
NM_001286644.1 Intron NP_001273573.1
NM_022457.6 Intron NP_071902.2
XM_005245447.2 Intron XP_005245504.1
XM_005245448.2 Intron XP_005245505.1
XM_006711487.2 Intron XP_006711550.1
XM_011509881.1 Intron XP_011508183.1
XM_017002059.1 Intron XP_016857548.1
XM_017002060.1 Intron XP_016857549.1
XM_017002061.1 Intron XP_016857550.1
XM_017002062.1 Intron XP_016857551.1
XM_017002063.1 Intron XP_016857552.1
XM_017002064.1 Intron XP_016857553.1
XM_017002065.1 Intron XP_016857554.1
XM_017002066.1 Intron XP_016857555.1
XM_017002067.1 Intron XP_016857556.1
XM_017002068.1 Intron XP_016857557.1
XM_017002069.1 Intron XP_016857558.1
XM_017002070.1 Intron XP_016857559.1
XM_017002071.1 Intron XP_016857560.1
XM_017002072.1 Intron XP_016857561.1
XM_017002073.1 Intron XP_016857562.1
XM_017002074.1 Intron XP_016857563.1
XM_017002075.1 Intron XP_016857564.1
XM_017002076.1 Intron XP_016857565.1
XM_017002077.1 Intron XP_016857566.1
XM_017002078.1 Intron XP_016857567.1
XM_017002079.1 Intron XP_016857568.1
XM_017002080.1 Intron XP_016857569.1

View Full Product Details