Product Details

SNP ID: rs137977772
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:153969081 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCCTGCCCCCAGGGCAACCAGTT[A/C]TCCTATGCTCTATGAGGTTGTCTAT
Phenotype: MIM: 607138 MIM: 604671 MIM: 604740
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CREB3L4 PubMed Links

Gene Details

Gene: CREB3L4
Gene Name: cAMP responsive element binding protein 3 like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001255978.1	564	Missense Mutation	TAT,TCT	Y109S	NP_001242907.1
NM_001255979.1	564	Missense Mutation	TAT,TCT	Y109S	NP_001242908.1
NM_001255980.1	564	Missense Mutation	TAT,TCT	Y89S	NP_001242909.1
NM_001255981.1	564	Missense Mutation	TAT,TCT	Y89S	NP_001242910.1
NM_130898.3	564	Missense Mutation	TAT,TCT	Y109S	NP_570968.1
XM_006711172.2	564	Missense Mutation	TAT,TCT	Y89S	XP_006711235.1
XM_017000372.1	564	Missense Mutation	TAT,TCT	Y89S	XP_016855861.1

Gene: JTB
Gene Name: jumping translocation breakpoint

There are no transcripts associated with this gene.

Gene: MIR6737
Gene Name: microRNA 6737

There are no transcripts associated with this gene.

Gene: SLC39A1
Gene Name: solute carrier family 39 member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271957.1	564	Intron			NP_001258886.1
NM_001271958.1	564	Intron			NP_001258887.1
NM_001271959.1	564	Intron			NP_001258888.1
NM_001271960.1	564	Intron			NP_001258889.1
NM_001271961.1	564	Intron			NP_001258890.1
NM_014437.4	564	Intron			NP_055252.2

View Full Product Details