Product Details
- SNP ID
-
rs140444624
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
16
- Location
-
Chr.1:182600492 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGCAGGTTCATCCTCGTCAGCTCGT[A/G]GGTCTCATGGTCAATGTTGACCTGC
- Phenotype
-
MIM: 602514
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
RGS16
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1144566] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- RGS16
- Gene Name
- regulator of G-protein signaling 16
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_002928.3 |
563 |
Missense Mutation |
|
|
NP_002919.3 |
View Full Product Details