Product Details
- SNP ID
-
rs144170950
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
9
- Location
-
Chr.1:154205607 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GATAGAAGCAGATTACCTGTCGACC[C/G]TCTTCTTAAGTCCCATGGCCTTTTG
- Phenotype
-
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
C1orf189
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs74957241] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C1orf189
- Gene Name
- chromosome 1 open reading frame 189
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001010979.2 |
123 |
Missense Mutation |
ACG,AGG |
T22R |
NP_001010979.1 |
- Gene
- C1orf43
- Gene Name
- chromosome 1 open reading frame 43
There are no transcripts associated with this gene.
View Full Product Details