Product Details

SNP ID: rs145204847
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:151166179 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTCTTTCAAGAGGGAAGGAGACGA[C/T]TGGAGTCAACTCAATGTGCTCAAAG
Phenotype: MIM: 608095 MIM: 605834 MIM: 612112
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LYSMD1 PubMed Links

Gene Details

Gene: LYSMD1
Gene Name: LysM domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136543.1	158	Intron			NP_001130015.1
NM_212551.4	158	Intron			NP_997716.1

Gene: SCNM1
Gene Name: sodium channel modifier 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204856.1	158	UTR 5			NP_001191785.1
NM_024041.3	158	Silent Mutation	GAC,GAT	D9D	NP_076946.1

Gene: TMOD4
Gene Name: tropomodulin 4

There are no transcripts associated with this gene.

Gene: TNFAIP8L2
Gene Name: TNF alpha induced protein 8 like 2

There are no transcripts associated with this gene.

Gene: TNFAIP8L2-SCNM1
Gene Name: TNFAIP8L2-SCNM1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204848.1	158	Intron			NP_001191777.1

View Full Product Details