Product Details

SNP ID: rs148008982
Assay Type: Functionally tested
NCBI dbSNP Submissions: 17
Location: Chr.1:156242277 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCCCTATTGGCCCTGGCCGCACTT[C/T]GCATCGCTGGCCAGGCAGGTGAGTG
Phenotype: MIM: 112260 MIM: 614579 MIM: 609176 MIM: 610962
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BGLAP PubMed Links

Gene Details

Gene: BGLAP
Gene Name: bone gamma-carboxyglutamate protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_199173.5	316	Missense Mutation	CGC,TGC	R16C	NP_954642.1

Gene: PAQR6
Gene Name: progestin and adipoQ receptor family member 6

There are no transcripts associated with this gene.

Gene: PMF1
Gene Name: polyamine-modulated factor 1

There are no transcripts associated with this gene.

Gene: PMF1-BGLAP
Gene Name: PMF1-BGLAP readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199661.1	316	Intron			NP_001186590.1
NM_001199662.1	316	Intron			NP_001186591.1
NM_001199663.1	316	Intron			NP_001186592.1
NM_001199664.1	316	Intron			NP_001186593.1

Gene: SMG5
Gene Name: SMG5, nonsense mediated mRNA decay factor

There are no transcripts associated with this gene.

View Full Product Details