Product Details

SNP ID: rs144622988
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:37850041 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGCTTATGACCCCTACGCTTATCC[C/T]AGCGACTATGATATGCACACAGGTG
Phenotype: MIM: 613383 MIM: 613556
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ANKRD54 PubMed Links

Gene Details

Gene: ANKRD54
Gene Name: ankyrin repeat domain 54

There are no transcripts associated with this gene.

Gene: EIF3L
Gene Name: eukaryotic translation initiation factor 3 subunit L

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242923.1	138	Silent Mutation	CCC,CCT	P20P	NP_001229852.1
NM_016091.3	138	Silent Mutation	CCC,CCT	P20P	NP_057175.1
XM_005261625.1	138	Intron			XP_005261682.1
XM_006724260.3	138	Silent Mutation	CCC,CCT	P63P	XP_006724323.1
XM_017028814.1	138	Intron			XP_016884303.1

Gene: MIR658
Gene Name: microRNA 658

There are no transcripts associated with this gene.

Gene: MIR659
Gene Name: microRNA 659

There are no transcripts associated with this gene.

View Full Product Details