Product Details

SNP ID
rs139786391
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.3:8733904 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GATGGCAGAAGAGCACACAGATCTC[A/G]AGGCCCAGATCGTCAAGGATATCCA
Phenotype
MIM: 601253
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
CAV3 PubMed Links
Additional Information
For this assay, SNP(s) [rs1974763] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CAV3
Gene Name
caveolin 3
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001234.4 105 Missense Mutation AAG,GAG K10E NP_001225.1
NM_033337.2 105 Missense Mutation AAG,GAG K10E NP_203123.1
Gene
SSUH2
Gene Name
ssu-2 homolog (C. elegans)
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001256748.1 105 Intron NP_001243677.1
NM_001256749.1 105 Intron NP_001243678.1
NM_015931.2 105 Intron NP_057015.1
XM_011533774.1 105 Intron XP_011532076.1
XM_017006510.1 105 Intron XP_016861999.1
XM_017006511.1 105 Intron XP_016862000.1
XM_017006512.1 105 Intron XP_016862001.1
XM_017006513.1 105 Intron XP_016862002.1
XM_017006514.1 105 Intron XP_016862003.1
XM_017006515.1 105 Intron XP_016862004.1
XM_017006516.1 105 Intron XP_016862005.1
XM_017006517.1 105 Intron XP_016862006.1
XM_017006518.1 105 Intron XP_016862007.1
XM_017006519.1 105 Intron XP_016862008.1
XM_017006520.1 105 Intron XP_016862009.1
XM_017006521.1 105 Intron XP_016862010.1
XM_017006522.1 105 Intron XP_016862011.1
XM_017006523.1 105 Intron XP_016862012.1
XM_017006524.1 105 Intron XP_016862013.1
XM_017006525.1 105 Intron XP_016862014.1
XM_017006526.1 105 Intron XP_016862015.1
XM_017006527.1 105 Intron XP_016862016.1
XM_017006528.1 105 Intron XP_016862017.1
XM_017006529.1 105 Intron XP_016862018.1
XM_017006530.1 105 Intron XP_016862019.1
XM_017006531.1 105 Intron XP_016862020.1
XM_017006532.1 105 Intron XP_016862021.1
XM_017006533.1 105 Intron XP_016862022.1
XM_017006534.1 105 Intron XP_016862023.1
XM_017006535.1 105 Intron XP_016862024.1
XM_017006536.1 105 Intron XP_016862025.1
XM_017006537.1 105 Intron XP_016862026.1
XM_017006538.1 105 Intron XP_016862027.1
XM_017006539.1 105 Intron XP_016862028.1
XM_017006540.1 105 Intron XP_016862029.1
XM_017006541.1 105 Intron XP_016862030.1
XM_017006542.1 105 Intron XP_016862031.1

View Full Product Details