Product Details

SNP ID: rs141824939
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:51984145 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCTGCGTATCCGCACTGTCCAGCC[C/G]AAGCCTGACTATGGTGAGAAGACGG
Phenotype: MIM: 104620 MIM: 601832
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ABHD14A PubMed Links

Gene Details

Gene: ABHD14A
Gene Name: abhydrolase domain containing 14A

There are no transcripts associated with this gene.

Gene: ABHD14A-ACY1
Gene Name: ABHD14A-ACY1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316331.1	606	Silent Mutation	CCC,CCG	P117P	NP_001303260.1

Gene: ABHD14B
Gene Name: abhydrolase domain containing 14B

There are no transcripts associated with this gene.

Gene: ACY1
Gene Name: aminoacylase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000666.2	606	Silent Mutation	CCC,CCG	P27P	NP_000657.1
NM_001198895.1	606	Silent Mutation	CCC,CCG	P27P	NP_001185824.1
NM_001198896.1	606	Silent Mutation	CCC,CCG	P27P	NP_001185825.1
NM_001198897.1	606	Silent Mutation	CCC,CCG	P27P	NP_001185826.1
NM_001198898.1	606	Silent Mutation	CCC,CCG	P27P	NP_001185827.1

Gene: RPL29
Gene Name: ribosomal protein L29

There are no transcripts associated with this gene.

View Full Product Details