Product Details
- SNP ID
-
rs149428578
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:139456409 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TACAATTTTATTCCTTCTCATTTTA[A/C]TCCCCAGTGCATCACAGCATTCTTT
- Phenotype
-
MIM: 180280
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC100507291
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs201593612] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC100507291
- Gene Name
- uncharacterized LOC100507291
There are no transcripts associated with this gene.
- Gene
- RBP2
- Gene Name
- retinol binding protein 2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_004164.2 |
|
Intron |
|
|
NP_004155.2 |
View Full Product Details