Product Details
- SNP ID
-
rs147104606
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.4:2931561 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTTGGAGGGAGCCCCCTACCCGCTT[C/T]ACGGCAGCAACTTCCCCGCCAGGGT
- Phenotype
-
MIM: 102680
MIM: 610977
MIM: 611526
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ADD1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1263348] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ADD1
- Gene Name
- adducin 1
There are no transcripts associated with this gene.
- Gene
- MFSD10
- Gene Name
- major facilitator superfamily domain containing 10
- Gene
- NOP14
- Gene Name
- NOP14 nucleolar protein
There are no transcripts associated with this gene.
- Gene
- NOP14-AS1
- Gene Name
- NOP14 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details