Product Details

SNP ID: rs139820365
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33417521 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCGACCTTCTCGTTGGGGCAAGTAA[C/G]AAAGGCTGCAGAGACCGAGCCCGGA
Phenotype: MIM: 616953 MIM: 603763 MIM: 602881 MIM: 603384
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CUTA PubMed Links

Gene Details

Gene: CUTA
Gene Name: cutA divalent cation tolerance homolog (E. coli)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014433.2	768	Missense Mutation	CTT,GTT	L92V	NP_001014433.1
NM_001014837.1	768	Missense Mutation	CTT,GTT	L50V	NP_001014837.1
NM_001014838.1	768	Missense Mutation	CTT,GTT	L50V	NP_001014838.1
NM_001014840.1	768	Missense Mutation	CTT,GTT	L73V	NP_001014840.1
NM_015921.2	768	Missense Mutation	CTT,GTT	L50V	NP_057005.1

Gene: KIFC1
Gene Name: kinesin family member C1

There are no transcripts associated with this gene.

Gene: PHF1
Gene Name: PHD finger protein 1

There are no transcripts associated with this gene.

Gene: SYNGAP1
Gene Name: synaptic Ras GTPase activating protein 1

There are no transcripts associated with this gene.

View Full Product Details