Product Details

SNP ID: rs145145776
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:43055993 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAGCCCCAAGAGGATGCGCATCCC[C/T]TTCCCGAGCAGCAACTAAAAGACAG
Phenotype: MIM: 609577 MIM: 611822
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CUL7 PubMed Links

Gene Details

Gene: CUL7
Gene Name: cullin 7

There are no transcripts associated with this gene.

Gene: KLC4
Gene Name: kinesin light chain 4

There are no transcripts associated with this gene.

Gene: MRPL2
Gene Name: mitochondrial ribosomal protein L2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300848.1	520	Missense Mutation	AGG,GGG	R179G	NP_001287777.1
NM_015950.4	520	Missense Mutation	AGG,GGG	R179G	NP_057034.2
XM_005249161.4	520	Missense Mutation	AGG,GGG	R147G	XP_005249218.1

View Full Product Details