Product Details

SNP ID: rs142949198
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:143382873 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAAGTCCAGTACCAAGCCTGCAGCC[G/T]GGGGCACAGCACCCCTGCCTCCTTG
Phenotype: MIM: 179610 MIM: 602002
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: EPHA1 PubMed Links

Gene Details

Gene: EPHA1
Gene Name: EPH receptor A1

There are no transcripts associated with this gene.

Gene: FAM131B
Gene Name: family with sequence similarity 131 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031690.2	627	Intron			NP_001026860.2
NM_001278297.1	627	Intron			NP_001265226.1
NM_014690.4	627	Intron			NP_055505.3
XM_005250073.3	627	Intron			XP_005250130.1
XM_006716186.2	627	Intron			XP_006716249.1

Gene: LOC100507507
Gene Name: uncharacterized LOC100507507

There are no transcripts associated with this gene.

Gene: MIR6892
Gene Name: microRNA 6892

There are no transcripts associated with this gene.

Gene: ZYX
Gene Name: zyxin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001010972.1	627	Missense Mutation	GGG,TGG	G192W	NP_001010972.1
NM_003461.4	627	Missense Mutation	GGG,TGG	G192W	NP_003452.1
XM_011516569.2	627	Missense Mutation	GGG,TGG	G161W	XP_011514871.2
XM_017012587.1	627	Missense Mutation	GGG,TGG	G251W	XP_016868076.1

View Full Product Details