Product Details

SNP ID: rs150794936
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100880859 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGAAGAGTTGGAGAACCATCAGTT[C/T]TTGGGTATTGGCTGAACTCATGGAG
Phenotype: MIM: 100740 MIM: 614469 MIM: 602933 MIM: 611481
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACHE PubMed Links

Gene Details

Gene: ACHE
Gene Name: acetylcholinesterase (Cartwright blood group)

There are no transcripts associated with this gene.

Gene: SRRT
Gene Name: serrate, RNA effector molecule

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128852.1		Intron			NP_001122324.1
NM_001128853.1		Intron			NP_001122325.1
NM_001128854.1		Intron			NP_001122326.1
NM_015908.5		Intron			NP_056992.4
XM_005250405.2		Intron			XP_005250462.1
XM_005250406.2		Intron			XP_005250463.1
XM_005250407.2		Intron			XP_005250464.1
XM_005250408.2		Intron			XP_005250465.1
XM_017012290.1		Intron			XP_016867779.1
XM_017012291.1		Intron			XP_016867780.1

Gene: TRIP6
Gene Name: thyroid hormone receptor interactor 6

There are no transcripts associated with this gene.

Gene: UFSP1
Gene Name: UFM1 specific peptidase 1 (inactive)

There are no transcripts associated with this gene.

View Full Product Details