Product Details

SNP ID: rs142310829
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144466443 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCATGTACGCCTTTTACTCGTTGCT[C/T]ATCTACATCTTCTACAGCCTCTTCC
Phenotype: MIM: 616635 MIM: 603621 MIM: 615216
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYHR1 PubMed Links

Gene Details

Gene: CYHR1
Gene Name: cysteine and histidine rich 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001129888.1	107	Intron			NP_001123360.1
NM_032687.3	107	Intron			NP_116076.1
NM_138496.1	107	Intron			NP_612505.1
XM_006716560.3	107	Intron			XP_006716623.1
XM_006716561.3	107	Intron			XP_006716624.1
XM_006716562.3	107	Intron			XP_006716625.2
XM_011517051.1	107	Intron			XP_011515353.1
XM_017013463.1	107	Intron			XP_016868952.1
XM_017013464.1	107	Intron			XP_016868953.1
XM_017013465.1	107	Intron			XP_016868954.1
XM_017013466.1	107	Intron			XP_016868955.1

Gene: FOXH1
Gene Name: forkhead box H1

There are no transcripts associated with this gene.

Gene: KIFC2
Gene Name: kinesin family member C2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145754.3	107	Silent Mutation	CTC,CTT	L8L	NP_665697.1
XM_005272357.3	107	Silent Mutation	CTC,CTT	L8L	XP_005272414.1
XM_011517362.2	107	Silent Mutation	CTC,CTT	L8L	XP_011515664.1

View Full Product Details