Product Details

SNP ID: rs147689284
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:154013054 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTCCCCAGCTACCTTCCACGGCT[A/G]TGGGCCGGGATCCTGGGCCACTCCC
Phenotype: MIM: 300283 MIM: 300005 MIM: 300929
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IRAK1 PubMed Links

Gene Details

Gene: IRAK1
Gene Name: interleukin 1 receptor associated kinase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001025242.1	1930	Missense Mutation	ACA,ATA	T610I	NP_001020413.1
NM_001025243.1	1930	Missense Mutation	ACA,ATA	T561I	NP_001020414.1
NM_001569.3	1930	Missense Mutation	ACA,ATA	T640I	NP_001560.2
XM_005274668.3	1930	Missense Mutation	ACA,ATA	T636I	XP_005274725.1
XM_011531158.2	1930	Missense Mutation	ACA,ATA	T531I	XP_011529460.1

Gene: MECP2
Gene Name: methyl-CpG binding protein 2

There are no transcripts associated with this gene.

Gene: MIR718
Gene Name: microRNA 718

There are no transcripts associated with this gene.

View Full Product Details