Product Details

SNP ID: rs11544587
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:132370313 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCAGCTGGAGCAGGAGAGCTGTC[C/T]GGATGGCTGGGAGTTCAGTCAGGAC
Phenotype: MIM: 603377
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC553103 PubMed Links

Gene Details

Gene: LOC553103
Gene Name: uncharacterized LOC553103

There are no transcripts associated with this gene.

Gene: MIR3936
Gene Name: microRNA 3936

There are no transcripts associated with this gene.

Gene: SLC22A5
Gene Name: solute carrier family 22 member 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308122.1	182	Missense Mutation	CCG,CTG	P114L	NP_001295051.1
NM_003060.3	182	Missense Mutation	CCG,CTG	P114L	NP_003051.1
XM_011543590.2	182	UTR 5			XP_011541892.1
XM_017009778.1	182	UTR 5			XP_016865267.1

View Full Product Details