Product Details

SNP ID

rs1043207

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.14:22900785 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

CTTGCCTTTTGTACAAAGTTTTTAT[G/A]TATATATATATGTATATATATTTAT

Phenotype

Polymorphism

G/A, Transition Substitution

Allele Nomenclature

Literature Links

RBM23 PubMed Links

Additional Information

For this assay, SNP(s) [rs112725825] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

RBM23

Gene Name

RNA binding motif protein 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077351.1	2624	UTR 3			NP_001070819.1
NM_001077352.1	2624	UTR 3			NP_001070820.1
NM_001308044.1	2624	UTR 3			NP_001294973.1
NM_018107.4	2624	UTR 3			NP_060577.3
XM_011536890.2	2624	UTR 3			XP_011535192.1
XM_011536892.2	2624	UTR 3			XP_011535194.1
XM_011536893.2	2624	UTR 3			XP_011535195.1
XM_011536894.2	2624	UTR 3			XP_011535196.1
XM_011536895.2	2624	UTR 3			XP_011535197.1
XM_011536896.2	2624	Intron			XP_011535198.1
XM_011536897.2	2624	UTR 3			XP_011535199.1
XM_011536900.1	2624	UTR 3			XP_011535202.1
XM_011536902.1	2624	UTR 3			XP_011535204.1
XM_011536903.1	2624	UTR 3			XP_011535205.1
XM_011536904.1	2624	UTR 3			XP_011535206.1
XM_011536905.1	2624	UTR 3			XP_011535207.1
XM_011536906.1	2624	UTR 3			XP_011535208.1
XM_017021398.1	2624	UTR 3			XP_016876887.1
XM_017021399.1	2624	UTR 3			XP_016876888.1
XM_017021400.1	2624	UTR 3			XP_016876889.1
XM_017021401.1	2624	UTR 3			XP_016876890.1
XM_017021402.1	2624	UTR 3			XP_016876891.1
XM_017021403.1	2624	UTR 3			XP_016876892.1
XM_017021404.1	2624	UTR 3			XP_016876893.1
XM_017021405.1	2624	UTR 3			XP_016876894.1
XM_017021406.1	2624	UTR 3			XP_016876895.1
XM_017021407.1	2624	UTR 3			XP_016876896.1
XM_017021408.1	2624	UTR 3			XP_016876897.1
XM_017021409.1	2624	UTR 3			XP_016876898.1
XM_017021410.1	2624	UTR 3			XP_016876899.1
XM_017021411.1	2624	UTR 3			XP_016876900.1
XM_017021412.1	2624	Intron			XP_016876901.1
XM_017021413.1	2624	Intron			XP_016876902.1
XM_017021414.1	2624	UTR 3			XP_016876903.1
XM_017021415.1	2624	UTR 3			XP_016876904.1
XM_017021416.1	2624	UTR 3			XP_016876905.1
XM_017021417.1	2624	UTR 3			XP_016876906.1
XM_017021418.1	2624	UTR 3			XP_016876907.1
XM_017021419.1	2624	UTR 3			XP_016876908.1
XM_017021420.1	2624	UTR 3			XP_016876909.1

View Full Product Details