Product Details

SNP ID: rs1048774
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33201434 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCATGGCCACAGCCATGCCCATGG[C/T]CATGGCCACACTCACGAGAGCATCT
Phenotype: MIM: 120290 MIM: 601417 MIM: 611500 MIM: 602045 MIM: 180246 MIM: 601416
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: COL11A2 PubMed Links

Gene Details

Gene: COL11A2
Gene Name: collagen type XI alpha 2

There are no transcripts associated with this gene.

Gene: HSD17B8
Gene Name: hydroxysteroid 17-beta dehydrogenase 8

There are no transcripts associated with this gene.

Gene: MIR219A1
Gene Name: microRNA 219a-1

There are no transcripts associated with this gene.

Gene: RING1
Gene Name: ring finger protein 1

There are no transcripts associated with this gene.

Gene: RXRB
Gene Name: retinoid X receptor beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270401.1	609	Intron			NP_001257330.1
NM_001291989.1	609	Intron			NP_001278918.1
NM_021976.4	609	Intron			NP_068811.1
XM_005249278.2	609	Intron			XP_005249335.1
XM_011514796.2	609	Intron			XP_011513098.1
XM_017011176.1	609	Intron			XP_016866665.1

Gene: SLC39A7
Gene Name: solute carrier family 39 member 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077516.1	609	Silent Mutation	GGC,GGT	G63G	NP_001070984.1
NM_001288777.1	609	Intron			NP_001275706.1
NM_006979.2	609	Silent Mutation	GGC,GGT	G63G	NP_008910.2

View Full Product Details