Product Details

SNP ID: rs11641726
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:89825211 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGTAATTACCATCTTCTGCTCAAAT[A/G]TCCCCGGCCAGTGCTGCACTGTGGC
Phenotype: MIM: 607139 MIM: 609217
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FANCA PubMed Links

Gene Details

Gene: FANCA
Gene Name: Fanconi anemia complementation group A

There are no transcripts associated with this gene.

Gene: LOC107984817
Gene Name: uncharacterized LOC107984817

There are no transcripts associated with this gene.

Gene: SPIRE2
Gene Name: spire type actin nucleation factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032451.1		Intron			NP_115827.1
XM_011523379.1		Intron			XP_011521681.1
XM_011523380.2		Intron			XP_011521682.1
XM_011523381.1		Intron			XP_011521683.1
XM_011523384.1		Intron			XP_011521686.1
XM_011523385.1		Intron			XP_011521687.1
XM_017023779.1		Intron			XP_016879268.1
XM_017023780.1		Intron			XP_016879269.1
XM_017023781.1		Intron			XP_016879270.1

View Full Product Details