Product Details

SNP ID: rs182005604
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33277900 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAGACCCTCAGCGGGCTGAACTGG[G/T]CTGAGAAACACTGCCCCATGGCCCG
Phenotype: MIM: 603095 MIM: 180473 MIM: 603443 MIM: 611440
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: B3GALT4 PubMed Links

Gene Details

Gene: B3GALT4
Gene Name: beta-1,3-galactosyltransferase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003782.3	761	Missense Mutation	GCT,TCT	A161S	NP_003773.1

Gene: MIR6873
Gene Name: microRNA 6873

There are no transcripts associated with this gene.

Gene: RPS18
Gene Name: ribosomal protein S18

There are no transcripts associated with this gene.

Gene: VPS52
Gene Name: VPS52, GARP complex subunit

There are no transcripts associated with this gene.

Gene: WDR46
Gene Name: WD repeat domain 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164267.1	761	Intron			NP_001157739.1
NM_005452.5	761	Intron			NP_005443.3
XM_017011484.1	761	Intron			XP_016866973.1
XM_017011485.1	761	Intron			XP_016866974.1
XM_017011486.1	761	Intron			XP_016866975.1
XM_017011487.1	761	Intron			XP_016866976.1

View Full Product Details