Product Details

SNP ID: rs183281002
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49871813 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGGAACAGCCTGGGACACTCACC[A/G]TCTGTACTCTCGGGGTCTGACTCAC
Phenotype: MIM: 610221 MIM: 605610 MIM: 616659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AKT1S1 PubMed Links

Gene Details

Gene: AKT1S1
Gene Name: AKT1 substrate 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098632.2	839	Silent Mutation	GAC,GAT	D152D	NP_001092102.1
NM_001098633.3	839	Silent Mutation	GAC,GAT	D152D	NP_001092103.1
NM_001278159.1	839	Silent Mutation	GAC,GAT	D152D	NP_001265088.1
NM_001278160.1	839	Silent Mutation	GAC,GAT	D152D	NP_001265089.1
NM_032375.5	839	Silent Mutation	GAC,GAT	D172D	NP_115751.3

Gene: PNKP
Gene Name: polynucleotide kinase 3'-phosphatase

There are no transcripts associated with this gene.

Gene: TBC1D17
Gene Name: TBC1 domain family member 17

There are no transcripts associated with this gene.

View Full Product Details