Product Details

SNP ID

rs184425136

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99648374 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GTGATTGACGTGCACAACCGTGCCC[A/G]AATGGTAACAATGGGCATCGTTCGC

Phenotype

MIM: 607815

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	625	Intron			NP_001190994.1
NM_001204066.1	625	Intron			NP_001190995.1
NM_001204067.1	625	Intron			NP_001190996.1
NM_001204068.1	625	Intron			NP_001190997.1
NM_001204069.1	625	Intron			NP_001190998.1
NM_001204070.1	625	Intron			NP_001190999.1
NM_001204079.1	625	Intron			NP_001191008.1
NM_001204080.1	625	Intron			NP_001191009.1
NM_001204081.1	625	Intron			NP_001191010.1
NM_020140.3	625	Intron			NP_064525.1
NM_152788.4	625	Intron			NP_690001.3
NM_181670.3	625	Intron			NP_858056.2
XM_005269028.4	625	Intron			XP_005269085.1
XM_005269029.4	625	Intron			XP_005269086.1
XM_005269032.3	625	Intron			XP_005269089.1
XM_006719504.3	625	Intron			XP_006719567.1
XM_006719505.3	625	Intron			XP_006719568.1
XM_006719506.3	625	Intron			XP_006719569.1
XM_006719507.3	625	Intron			XP_006719570.1
XM_006719508.3	625	Intron			XP_006719571.1
XM_006719509.3	625	Intron			XP_006719572.1
XM_006719510.3	625	Intron			XP_006719573.1
XM_006719512.3	625	Intron			XP_006719575.1
XM_006719513.3	625	Intron			XP_006719576.1
XM_006719514.3	625	Intron			XP_006719577.1
XM_011538571.2	625	Intron			XP_011536873.1
XM_017019651.1	625	Intron			XP_016875140.1
XM_017019652.1	625	Intron			XP_016875141.1
XM_017019653.1	625	Intron			XP_016875142.1
XM_017019654.1	625	Intron			XP_016875143.1
XM_017019655.1	625	Intron			XP_016875144.1
XM_017019656.1	625	Intron			XP_016875145.1
XM_017019657.1	625	Intron			XP_016875146.1
XM_017019658.1	625	Intron			XP_016875147.1
XM_017019659.1	625	Intron			XP_016875148.1
XM_017019660.1	625	Intron			XP_016875149.1
XM_017019661.1	625	Intron			XP_016875150.1
XM_017019662.1	625	Intron			XP_016875151.1
XM_017019663.1	625	Intron			XP_016875152.1
XM_017019664.1	625	Intron			XP_016875153.1
XM_017019665.1	625	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	625	Missense Mutation	CAA,CGA	Q67R	NP_699195.1

View Full Product Details