Product Details

SNP ID: rs187574926
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:27963612 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGACATCAGCATGCTGCGGCTCTTC[A/G]AGACCTTCTTGGAGACGGCACCACA
Phenotype: MIM: 601655
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EYA3 PubMed Links

Gene Details

Gene: EYA3
Gene Name: EYA transcriptional coactivator and phosphatase 3

There are no transcripts associated with this gene.

Gene: SMPDL3B
Gene Name: sphingomyelin phosphodiesterase acid like 3B

There are no transcripts associated with this gene.

Gene: XKR8
Gene Name: XK related 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018053.3	1017	Missense Mutation	AAG,GAG	K137E	NP_060523.2
XM_011541679.2	1017	Silent Mutation	TCA,TCG	S100S	XP_011539981.1
XM_011541680.2	1017	Silent Mutation	TCA,TCG	S100S	XP_011539982.1

View Full Product Details