Product Details

SNP ID: rs188433120
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:153786231 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTCACATTCTCATTGTCCATGGAT[A/G]CCAGGACAGCCTTACGGATGGAGGT
Phenotype: MIM: 300089 MIM: 300214 MIM: 300090
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IDH3G PubMed Links

Gene Details

Gene: IDH3G
Gene Name: isocitrate dehydrogenase 3 (NAD(+)) gamma

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004135.3	1258	Missense Mutation	GCA,GTA	A354V	NP_004126.1
NM_174869.2	1258	Missense Mutation	GCA,GTA	A354V	NP_777358.1

Gene: PLXNB3
Gene Name: plexin B3

There are no transcripts associated with this gene.

Gene: SRPK3
Gene Name: SRSF protein kinase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001170760.1	1258	Intron			NP_001164231.1
NM_001170761.1	1258	Intron			NP_001164232.1
NM_014370.3	1258	Intron			NP_055185.2

Gene: SSR4
Gene Name: signal sequence receptor subunit 4

There are no transcripts associated with this gene.

View Full Product Details