Product Details

SNP ID: rs188609242
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:100978580 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGAATTCCGGAGCATTCCTGACATC[C/T]GCCGGAGCCGCCACCCACACTCCCT
Phenotype: MIM: 606075 MIM: 611848
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C10orf2 PubMed Links

Gene Details

Gene: C10orf2
Gene Name: chromosome 10 open reading frame 2

There are no transcripts associated with this gene.

Gene: MIR608
Gene Name: microRNA 608

There are no transcripts associated with this gene.

Gene: MRPL43
Gene Name: mitochondrial ribosomal protein L43

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308396.1	1393	Intron			NP_001295325.1
NM_032112.2	1393	Intron			NP_115488.2
NM_176792.2	1393	UTR 3			NP_789762.1
NM_176793.1	1393	Intron			NP_789763.1
NM_176794.1	1393	Intron			NP_789764.1
XM_005270231.2	1393	Intron			XP_005270288.1
XM_006718035.3	1393	Intron			XP_006718098.1
XM_017016790.1	1393	Intron			XP_016872279.1

Gene: SEMA4G
Gene Name: semaphorin 4G

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001203244.1	1393	Missense Mutation	CGC,TGC	R195C	NP_001190173.1
NM_017893.3	1393	Missense Mutation	CGC,TGC	R195C	NP_060363.2
XM_005270008.2	1393	Missense Mutation	CGC,TGC	R195C	XP_005270065.1

View Full Product Details