Product Details

SNP ID: rs190772368
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74462202 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCCTTTCGGAGGAAAGCCAAGTC[A/G]TCAGGGTCACCAACCTCTAGCATAT
Phenotype: MIM: 616456 MIM: 601336 MIM: 611857 MIM: 606961
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: INO80B PubMed Links

Gene Details

Gene: INO80B
Gene Name: INO80 complex subunit B

There are no transcripts associated with this gene.

Gene: INO80B-WBP1
Gene Name: INO80B-WBP1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: MOGS
Gene Name: mannosyl-oligosaccharide glucosidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001146158.1	1513	Silent Mutation	GAC,GAT	D423D	NP_001139630.1
NM_006302.2	1513	Silent Mutation	GAC,GAT	D529D	NP_006293.2
XM_017004876.1	1513	Silent Mutation	GAC,GAT	D254D	XP_016860365.1
XM_017004877.1	1513	Silent Mutation	GAC,GAT	D254D	XP_016860366.1

Gene: MRPL53
Gene Name: mitochondrial ribosomal protein L53

There are no transcripts associated with this gene.

Gene: WBP1
Gene Name: WW domain binding protein 1

There are no transcripts associated with this gene.

View Full Product Details