Product Details

SNP ID: rs193253806
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:45152973 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTGGGGTCCACGACCAGGATGAA[A/G]ATGAAGGGCGCGTGGCTGTCGGACA
Phenotype: MIM: 610396
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NKPD1 PubMed Links

Gene Details

Gene: NKPD1
Gene Name: NTPase, KAP family P-loop domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198478.3	3442	Silent Mutation	ATC,ATT	I488I	NP_940880.3
XM_011526799.2	3442	Silent Mutation	ATC,ATT	I515I	XP_011525101.1
XM_011526802.2	3442	Silent Mutation	ATC,ATT	I488I	XP_011525104.1
XM_011526804.2	3442	Silent Mutation	ATC,ATT	I369I	XP_011525106.1
XM_011526805.2	3442	Silent Mutation	ATC,ATT	I313I	XP_011525107.1

Gene: PPP1R37
Gene Name: protein phosphatase 1 regulatory subunit 37

There are no transcripts associated with this gene.

Gene: TRAPPC6A
Gene Name: trafficking protein particle complex 6A

There are no transcripts associated with this gene.

View Full Product Details