Product Details

SNP ID

rs192871611

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99648197 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GACATGGAGGACTGCTGTATGCTAC[C/T]GTATTACACGGCCCAAAGCAGCCCC

Phenotype

MIM: 607815

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	448	Intron			NP_001190994.1
NM_001204066.1	448	Intron			NP_001190995.1
NM_001204067.1	448	Intron			NP_001190996.1
NM_001204068.1	448	Intron			NP_001190997.1
NM_001204069.1	448	Intron			NP_001190998.1
NM_001204070.1	448	Intron			NP_001190999.1
NM_001204079.1	448	Intron			NP_001191008.1
NM_001204080.1	448	Intron			NP_001191009.1
NM_001204081.1	448	Intron			NP_001191010.1
NM_020140.3	448	Intron			NP_064525.1
NM_152788.4	448	Intron			NP_690001.3
NM_181670.3	448	Intron			NP_858056.2
XM_005269028.4	448	Intron			XP_005269085.1
XM_005269029.4	448	Intron			XP_005269086.1
XM_005269032.3	448	Intron			XP_005269089.1
XM_006719504.3	448	Intron			XP_006719567.1
XM_006719505.3	448	Intron			XP_006719568.1
XM_006719506.3	448	Intron			XP_006719569.1
XM_006719507.3	448	Intron			XP_006719570.1
XM_006719508.3	448	Intron			XP_006719571.1
XM_006719509.3	448	Intron			XP_006719572.1
XM_006719510.3	448	Intron			XP_006719573.1
XM_006719512.3	448	Intron			XP_006719575.1
XM_006719513.3	448	Intron			XP_006719576.1
XM_006719514.3	448	Intron			XP_006719577.1
XM_011538571.2	448	Intron			XP_011536873.1
XM_017019651.1	448	Intron			XP_016875140.1
XM_017019652.1	448	Intron			XP_016875141.1
XM_017019653.1	448	Intron			XP_016875142.1
XM_017019654.1	448	Intron			XP_016875143.1
XM_017019655.1	448	Intron			XP_016875144.1
XM_017019656.1	448	Intron			XP_016875145.1
XM_017019657.1	448	Intron			XP_016875146.1
XM_017019658.1	448	Intron			XP_016875147.1
XM_017019659.1	448	Intron			XP_016875148.1
XM_017019660.1	448	Intron			XP_016875149.1
XM_017019661.1	448	Intron			XP_016875150.1
XM_017019662.1	448	Intron			XP_016875151.1
XM_017019663.1	448	Intron			XP_016875152.1
XM_017019664.1	448	Intron			XP_016875153.1
XM_017019665.1	448	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	448	Missense Mutation	CCG,CTG	P8L	NP_699195.1

View Full Product Details