Product Details

SNP ID: rs201850505
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:73803303 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGAGGGGTCTGGGAGGAGGCTGA[A/G]ATCACCTGATAGAAGGTATAGTTCA
Phenotype: MIM: 602123 MIM: 603268
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CAMK2G PubMed Links

Gene Details

Gene: CAMK2G
Gene Name: calcium/calmodulin dependent protein kinase II gamma

There are no transcripts associated with this gene.

Gene: NDST2
Gene Name: N-deacetylase and N-sulfotransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003635.3	3003	Silent Mutation	ATC,ATT	I733I	NP_003626.1
XM_005270255.3	3003	Silent Mutation	ATC,ATT	I733I	XP_005270312.1
XM_005270256.3	3003	Silent Mutation	ATC,ATT	I359I	XP_005270313.1
XM_011540310.2	3003	Silent Mutation	ATC,ATT	I733I	XP_011538612.1
XM_017016857.1	3003	Silent Mutation	ATC,ATT	I256I	XP_016872346.1

Gene: ZSWIM8
Gene Name: zinc finger SWIM-type containing 8

There are no transcripts associated with this gene.

Gene: ZSWIM8-AS1
Gene Name: ZSWIM8 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details