Product Details

SNP ID: rs201806866
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:2402815 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCTGCCTGGGGAGGAGGATTCAG[A/G]TCCTGATGAGCCGCCCTCACCCCCG
Phenotype: MIM: 186845 MIM: 604600 MIM: 603852
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CD81 PubMed Links

Gene Details

Gene: CD81
Gene Name: CD81 molecule

There are no transcripts associated with this gene.

Gene: TRPM5
Gene Name: transient receptor potential cation channel subfamily M member 5

There are no transcripts associated with this gene.

Gene: TSSC4
Gene Name: tumor suppressing subtransferable candidate 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297658.1	814	Missense Mutation	GAT,GGT	D61G	NP_001284587.1
NM_001297659.1	814	Missense Mutation	GAT,GGT	D61G	NP_001284588.1
NM_001297660.1	814	Missense Mutation	GAT,GGT	D61G	NP_001284589.1
NM_001297661.1	814	Intron			NP_001284590.1
NM_005706.3	814	Missense Mutation	GAT,GGT	D61G	NP_005697.2
XM_006718118.2	814	Missense Mutation	GAT,GGT	D61G	XP_006718181.1
XM_011519830.2	814	Missense Mutation	GAT,GGT	D61G	XP_011518132.1

View Full Product Details