Product Details
- SNP ID
-
rs202094273
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:124016359 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTGTTGTCATTTATCTGAGGCCAG[G/T]CTCCATGGATGCCATGGATGGAGTT
- Phenotype
-
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
OR10G4
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs148404016,rs4936882] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR10G4
- Gene Name
- olfactory receptor family 10 subfamily G member 4
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001004462.1 |
785 |
Missense Mutation |
GGC,GTC |
G262V |
NP_001004462.1 |
- Gene
- OR10G9
- Gene Name
- olfactory receptor family 10 subfamily G member 9
There are no transcripts associated with this gene.
View Full Product Details