Product Details

SNP ID: rs201841796
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:5507953 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGAGTAGGAGGCGAGGTGCTTCAG[C/T]AGCTAGGACCTGTAGACCCTGCTCA
Phenotype: MIM: 605473
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: OR51B5 PubMed Links

Gene Details

Gene: OR51B5
Gene Name: olfactory receptor family 51 subfamily B member 5

There are no transcripts associated with this gene.

Gene: UBQLN3
Gene Name: ubiquilin 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017481.2	1793	Missense Mutation	ACT,GCT	T536A	NP_059509.1
XM_011520144.2	1793	Missense Mutation	ACT,GCT	T536A	XP_011518446.1
XM_011520145.2	1793	Missense Mutation	ACT,GCT	T383A	XP_011518447.1

Gene: UBQLNL
Gene Name: ubiquilin-like

There are no transcripts associated with this gene.

View Full Product Details