Product Details

SNP ID: rs201166537
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:62617004 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGCTCACCTCCTCAAACAGCTCCC[A/G]GCTGTAGGTGTTGTCATCGTCAGCA
Phenotype: MIM: 606374 MIM: 104160 MIM: 180721
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: B3GAT3 PubMed Links

Gene Details

Gene: B3GAT3
Gene Name: beta-1,3-glucuronyltransferase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001288721.1	829	Missense Mutation	CGG,TGG	R194W	NP_001275650.1
NM_001288722.1	829	Missense Mutation	CGG,TGG	R201W	NP_001275651.1
NM_001288723.1	829	Missense Mutation	CGG,TGG	R201W	NP_001275652.1
NM_012200.3	829	Missense Mutation	CGG,TGG	R201W	NP_036332.2

Gene: EML3
Gene Name: echinoderm microtubule associated protein like 3

There are no transcripts associated with this gene.

Gene: GANAB
Gene Name: glucosidase II alpha subunit

There are no transcripts associated with this gene.

Gene: ROM1
Gene Name: retinal outer segment membrane protein 1

There are no transcripts associated with this gene.

View Full Product Details