Product Details
- SNP ID
-
rs201604296
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:34342029 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTGAAGCGTTTCTTGATGGTGATT[A/C]GGTGTCGAGAGTATTTGTCATCTGG
- Phenotype
-
MIM: 606471
MIM: 608963
MIM: 604878
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
NOP10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs422388] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- NOP10
- Gene Name
- NOP10 ribonucleoprotein
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_018648.3 |
|
Intron |
|
|
NP_061118.1 |
- Gene
- NUTM1
- Gene Name
- NUT midline carcinoma family member 1
There are no transcripts associated with this gene.
- Gene
- SLC12A6
- Gene Name
- solute carrier family 12 member 6
There are no transcripts associated with this gene.
View Full Product Details