Product Details

SNP ID: rs201286464
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:63612479 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTCGGGCATCCCACACACCATCTG[C/G]TCCAGTTGTTTTGCTGTGAGGAGGG
Phenotype: MIM: 609088 MIM: 605109
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FBXL22 PubMed Links

Gene Details

Gene: FBXL22
Gene Name: F-box and leucine rich repeat protein 22

There are no transcripts associated with this gene.

Gene: HERC1
Gene Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003922.3	14399	Missense Mutation	GAC,GAG	D4724E	NP_003913.3
XM_017022699.1	14399	Missense Mutation	GAC,GAG	D4772E	XP_016878188.1
XM_017022700.1	14399	Missense Mutation	GAC,GAG	D4760E	XP_016878189.1
XM_017022701.1	14399	Missense Mutation	GAC,GAG	D4755E	XP_016878190.1
XM_017022702.1	14399	Missense Mutation	GAC,GAG	D4755E	XP_016878191.1
XM_017022703.1	14399	Missense Mutation	GAC,GAG	D4754E	XP_016878192.1
XM_017022704.1	14399	Missense Mutation	GAC,GAG	D4748E	XP_016878193.1
XM_017022705.1	14399	Missense Mutation	GAC,GAG	D4746E	XP_016878194.1
XM_017022706.1	14399	Intron			XP_016878195.1

View Full Product Details