Product Details
- SNP ID
-
rs200140846
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:45253281 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CAGTGGAGACTGGCACAGTGAACCC[A/G]GGGCTGGAGCTCATGGTAATCACCA
- Phenotype
-
MIM: 606208
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC101928414
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs11854484] are located under a probe and SNP(s) [rs17215668] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC101928414
- Gene Name
- uncharacterized LOC101928414
There are no transcripts associated with this gene.
- Gene
- SLC28A2
- Gene Name
- solute carrier family 28 member 2
View Full Product Details