Product Details

SNP ID: rs200817876
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:40815706 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGGTCTCTCAGGCTTATTTCTGA[G/T]GCCGGCTGAGTCTCCGGAGTTTCTT
Phenotype: MIM: 616844 MIM: 613256
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DNAJC17 PubMed Links

Gene Details

Gene: DNAJC17
Gene Name: DnaJ heat shock protein family (Hsp40) member C17

There are no transcripts associated with this gene.

Gene: PPP1R14D
Gene Name: protein phosphatase 1 regulatory inhibitor subunit 14D

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130143.1	608	Missense Mutation	ATC,CTC	I182L	NP_001123615.1
NM_017726.7	608	Missense Mutation	CAT,CCT	H143P	NP_060196.1
XM_017022372.1	608	UTR 3			XP_016877861.1

Gene: ZFYVE19
Gene Name: zinc finger FYVE-type containing 19

There are no transcripts associated with this gene.

View Full Product Details