Product Details

SNP ID: rs201146543
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30958751 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAAAGATGGATCAGGAAGGTGGGG[G/T]AGATGGGCAGAAGGCCCCGAGCTTC
Phenotype: MIM: 609085 MIM: 610930 MIM: 611052
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: FBXL19 PubMed Links

Gene Details

Gene: FBXL19
Gene Name: F-box and leucine rich repeat protein 19

There are no transcripts associated with this gene.

Gene: ORAI3
Gene Name: ORAI calcium release-activated calcium modulator 3

There are no transcripts associated with this gene.

Gene: SETD1A
Gene Name: SET domain containing 1A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014712.2	111	Missense Mutation	GGA,GTA	G7V	NP_055527.1
XM_005255723.1	111	Missense Mutation	GGA,GTA	G7V	XP_005255780.1
XM_006721106.3	111	Missense Mutation	GGA,GTA	G7V	XP_006721169.1
XM_017023909.1	111	Missense Mutation	GGA,GTA	G7V	XP_016879398.1

View Full Product Details