Product Details

SNP ID: rs201883457
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:3137425 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCCGAAGCCTGCCGCCAGCGCTTC[C/T]GGCAATTCTGCTACGGGGATGTGCA
Phenotype: MIM: 608387
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CASP16P PubMed Links

Gene Details

Gene: CASP16P
Gene Name: caspase 16, pseudogene

There are no transcripts associated with this gene.

Gene: ZNF213
Gene Name: zinc finger protein 213

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134655.1	560	Missense Mutation	CGG,TGG	R49W	NP_001128127.1
NM_004220.2	560	Missense Mutation	CGG,TGG	R49W	NP_004211.1
XM_011522652.2	560	Missense Mutation	CGG,TGG	R49W	XP_011520954.1

Gene: ZNF213-AS1
Gene Name: ZNF213 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

View Full Product Details