Product Details

SNP ID: rs200272908
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42022483 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGGTGCGAGAGCAGGTGCGTTTCT[A/G]TGACACCCGGGGGCTCCGAGATGGG
Phenotype: MIM: 601964 MIM: 604497
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJC7 PubMed Links

Gene Details

Gene: DNAJC7
Gene Name: DnaJ heat shock protein family (Hsp40) member C7

There are no transcripts associated with this gene.

Gene: NKIRAS2
Gene Name: NFKB inhibitor interacting Ras like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001349.2	244	Missense Mutation	TAT,TGT	Y60C	NP_001001349.1
NM_001144927.1	244	Missense Mutation	TAT,TGT	Y60C	NP_001138399.1
NM_001144928.1	244	Intron			NP_001138400.1
NM_001144929.1	244	Intron			NP_001138401.1
NM_017595.5	244	Missense Mutation	TAT,TGT	Y60C	NP_060065.2
XM_005257251.1	244	Missense Mutation	TAT,TGT	Y60C	XP_005257308.1

Gene: ZNF385C
Gene Name: zinc finger protein 385C

There are no transcripts associated with this gene.

View Full Product Details