Product Details

SNP ID: rs199846495
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:29574727 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCACTGCTTCTTCTCTCGGGTGGTG[A/G]TGGTGACCAGCTGCTTGGCAGCCTT
Phenotype: MIM: 608434
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ABHD15 PubMed Links

Gene Details

Gene: ABHD15
Gene Name: abhydrolase domain containing 15

There are no transcripts associated with this gene.

Gene: GIT1
Gene Name: GIT ArfGAP 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001085454.1	2475	Missense Mutation	ACC,ATC	T763I	NP_001078923.1
NM_014030.3	2475	Missense Mutation	ACC,ATC	T754I	NP_054749.2
XM_011524684.1	2475	Missense Mutation	ACC,ATC	T770I	XP_011522986.1
XM_011524685.1	2475	Missense Mutation	ACC,ATC	T761I	XP_011522987.1

Gene: TP53I13
Gene Name: tumor protein p53 inducible protein 13

There are no transcripts associated with this gene.

View Full Product Details