Product Details

SNP ID: rs199644477
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:76081290 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCACCCCTCAGCGATGGAGTTAG[A/G]GTTCCAGGCCCACGTGGTGAACGAG
Phenotype: MIM: 608163 MIM: 603691 MIM: 604858 MIM: 610935
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EXOC7 PubMed Links

Gene Details

Gene: EXOC7
Gene Name: exocyst complex component 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013839.3	640	UTR 3			NP_001013861.1
NM_001145297.3	640	UTR 3			NP_001138769.1
NM_001145298.3	640	UTR 3			NP_001138770.1
NM_001145299.3	640	UTR 3			NP_001138771.1
NM_001282313.1	640	UTR 3			NP_001269242.1
NM_001282314.1	640	Intron			NP_001269243.1
NM_015219.4	640	UTR 3			NP_056034.2
XM_006721786.3	640	UTR 3			XP_006721849.1
XM_006721787.3	640	UTR 3			XP_006721850.1
XM_006721788.3	640	UTR 3			XP_006721851.1
XM_006721789.3	640	UTR 3			XP_006721852.1
XM_011524571.2	640	UTR 3			XP_011522873.1
XM_011524572.2	640	Intron			XP_011522874.1
XM_017024397.1	640	UTR 3			XP_016879886.1

Gene: GALR2
Gene Name: galanin receptor 2

There are no transcripts associated with this gene.

Gene: SRP68
Gene Name: signal recognition particle 68

There are no transcripts associated with this gene.

Gene: ZACN
Gene Name: zinc activated ion channel

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_180990.3	640	Missense Mutation	GAG,GGG	E186G	NP_851321.2

View Full Product Details