Product Details

SNP ID

rs202151662

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.17:80415220 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATGGCCCTGGAGGCGGCGGGAGGGC[C/T]GCCGGAGGAAACGCTGTCACTGTGG

Phenotype

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ENDOV PubMed Links

Gene Details

Gene

ENDOV

Gene Name

endonuclease V

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164637.2	104	Missense Mutation	CCG,CTG	P9L	NP_001158109.1
NM_001164638.1	104	Missense Mutation	CCG,CTG	P9L	NP_001158110.1
NM_173627.4	104	Missense Mutation	CCG,CTG	P9L	NP_775898.2
XM_005257244.3	104	Missense Mutation	CCG,CTG	P9L	XP_005257301.1
XM_005257246.3	104	Missense Mutation	CCG,CTG	P9L	XP_005257303.1
XM_006721837.3	104	Missense Mutation	CCG,CTG	P9L	XP_006721900.1
XM_011524655.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522957.1
XM_011524656.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522958.1
XM_011524657.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522959.1
XM_011524658.2	104	Missense Mutation	CCG,CTG	P9L	XP_011522960.1
XM_011524660.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522962.1
XM_011524661.2	104	Missense Mutation	CCG,CTG	P9L	XP_011522963.1
XM_011524662.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522964.1
XM_011524663.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522965.1
XM_011524664.2	104	Intron			XP_011522966.1
XM_011524666.1	104	Intron			XP_011522968.1
XM_011524667.2	104	Intron			XP_011522969.1
XM_011524669.2	104	Missense Mutation	CCG,CTG	P9L	XP_011522971.1
XM_011524670.1	104	Missense Mutation	CCG,CTG	P9L	XP_011522972.1
XM_011524671.2	104	Missense Mutation	CCG,CTG	P9L	XP_011522973.1
XM_011524672.1	104	Intron			XP_011522974.1
XM_011524673.1	104	Intron			XP_011522975.1
XM_011524674.1	104	Intron			XP_011522976.1
XM_011524675.1	104	UTR 5			XP_011522977.1
XM_011524676.1	104	Intron			XP_011522978.1
XM_011524677.1	104	Intron			XP_011522979.1
XM_011524678.2	104	Intron			XP_011522980.1
XM_017024508.1	104	Intron			XP_016879997.1
XM_017024509.1	104	Intron			XP_016879998.1
XM_017024510.1	104	Missense Mutation	CCG,CTG	P9L	XP_016879999.1
XM_017024511.1	104	Missense Mutation	CCG,CTG	P9L	XP_016880000.1
XM_017024512.1	104	Intron			XP_016880001.1
XM_017024513.1	104	Intron			XP_016880002.1
XM_017024514.1	104	Intron			XP_016880003.1
XM_017024515.1	104	Intron			XP_016880004.1
XM_017024516.1	104	Intron			XP_016880005.1
XM_017024517.1	104	UTR 5			XP_016880006.1
XM_017024518.1	104	Intron			XP_016880007.1
XM_017024519.1	104	Intron			XP_016880008.1
XM_017024520.1	104	Intron			XP_016880009.1

Gene

LOC100294362

Gene Name

uncharacterized LOC100294362

There are no transcripts associated with this gene.

Gene

MIR4730

Gene Name

microRNA 4730

There are no transcripts associated with this gene.

View Full Product Details