Product Details

SNP ID: rs200471341
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:10287650 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTACTTGGTGGTGACCCTGAGGC[A/G]TGGAAGCCGGGTCATCTATTCCGAA
Phenotype: MIM: 147840 MIM: 614088 MIM: 601852
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ICAM1 PubMed Links

Gene Details

Gene: ICAM1
Gene Name: intercellular adhesion molecule 1

There are no transcripts associated with this gene.

Gene: ICAM4
Gene Name: intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039132.2	555	Silent Mutation	GCA,GCG	A144A	NP_001034221.1
NM_001544.4	555	Missense Mutation	CAT,CGT	H170R	NP_001535.1
NM_022377.3	555	Missense Mutation	CAT,CGT	H170R	NP_071772.1

Gene: ICAM5
Gene Name: intercellular adhesion molecule 5

There are no transcripts associated with this gene.

View Full Product Details