Product Details

SNP ID: rs200387099
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48750269 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGAAGGCCGCCTCCGGCTTAAAG[A/T]TCTTCAGGAACTCAGAGTCTGGCAG
Phenotype: MIM: 609436 MIM: 211100 MIM: 609278 MIM: 609623
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FGF21 PubMed Links

Gene Details

Gene: FGF21
Gene Name: fibroblast growth factor 21

There are no transcripts associated with this gene.

Gene: FUT1
Gene Name: fucosyltransferase 1 (H blood group)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000148.3	1988	Missense Mutation	AAC,ATC	N338I	NP_000139.1
XM_006723127.2	1988	Missense Mutation	AAC,ATC	N461I	XP_006723190.1
XM_017026552.1	1988	Missense Mutation	AAC,ATC	N461I	XP_016882041.1
XM_017026553.1	1988	Missense Mutation	AAC,ATC	N338I	XP_016882042.1

Gene: IZUMO1
Gene Name: izumo sperm-egg fusion 1

There are no transcripts associated with this gene.

Gene: RASIP1
Gene Name: Ras interacting protein 1

There are no transcripts associated with this gene.

View Full Product Details